Versions Compared

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.
Parameter NameDefault ValueDescription
FASTAfalseCreates .fasta/.fastq output. Requires the genome sequences in a folder specified by GEN_DIR. If a quality model is provided by parameter ERR_FILE, a .fastq file is produced. Otherwise read sequences are given as .fasta.
GEN_DIRnull

Path to the directory with the genomic sequences, i.e., one fasta file per chromosome/scaffold/contig with a file name corresponding to the identifiers of the first column in the GTF annotation.

ERR_FILEnull

Path to the file with the error model. With the values '35' or '76', default error models are provided for the corresponding read lengths, otherwise the path to a custom error model file is expected.

Section

Given a directory with genomic sequences split by chromosome GEN_DIR,

...

Flux Simulator provides the possibility to additionally output the read sequences in FASTA or FASTQ format. If no error model ERR_FILE

...

is provided, read sequences are an exact copy of the genomic sequence. Sequences of reads that are sequenced in antisense to the cDNA molecule are reverse complemented. Parts of the read that fall into the poly-A tail are correspondingly filled with a, respectively t characters whenever the read is produced in antisense direction.

...

As in the BED file, the read identifiers

...

are unique tags, composed of locus, transcript and fragment information from which they have been derived.

Example

Section

A BED line

Code Block
Chr1    28795    28871    Chr1:23259-31337W:AT1G01046.1:1:207:65:258:A    0    -    .    .    0,0,0    1    76    0

translates in a FASTA file to the line tuple 

 

Code Block
>Chr1:23259-31337W:AT1G01046.1:1:207:65:258:A
AACAAAGAAGCGTTAATTTATCGGTTATATCATTAAATTGTTAAAGTGAAAAGAATTTCTTATAACCTGACTGTTC

 

and can produce the FASTQ lines

 

Code Block
@Chr1:23259-31337W:AT1G01046.1:1:207:65:258:A
AACAAAGAAGCGTTAATTTATCGGTTATATCATTAAATTGTTAAAGTGAAAAGAATTTCTTATAACCTGACTGTTC
+
IIIIHIIIIIIIIIIIIIIHG<2BBIIIIIIFIIIIE<BEHIIIIBGDDIHFG<ACCCCCDD:66CFEGHIFFBHI

 

 

 

 

 

Examples:
Here an example for a BED line that represents a spliced read

...